Download to read offline
![INTERNATIONAL RESEARCH JOURNAL OF ENGINEERING AND TECHNOLOGY (IRJET) E-ISSN: 2395-0056 VOLUME: 07 ISSUE: 02 | FEB 2020 WWW.IRJET.NET P-ISSN: 2395-0072 IMPLEMENTATION OF DNA CRYPTOGRAPHY IN CLOUD COMPUTING AND USING SOCKET PROGRAMMING Priyanka agarwal1, sachin sharma2, Ritik sharma3 1Associate Professor, Dept. of ECE, Arya Institute of Engineering & Technology, Jaipur, Rajasthan, India 2,3Student, Dept. of ECE, Arya Institute of Engineering & Technology, Jaipur, Rajasthan, India -----------------------------------------------------------------------***--------------------------------------------------------------------- Abstract- In the field of distributed computing Cloud computing is the latest technology which provides various online and on-demand services for data storage & network services and etc. lots of organizations are excited to use cloud services cause of data security problems as the data lives on the cloud services provider’s servers. The BDEA (Bi-directional DNA Encryption Algorithm) is one of data security techniques. However, the presenting techniques eye on only for ASCII character set, ignoring the non- English user of the cloud computing Keywords-Cloud computing, Data security issues, Bi- DirectionalDNAEncryptionAlgorithm,DNAdigitalcode, SocketProgramming.) 1. INTRODUCTION Cloud computing has newly reached status and developed into a chief trend in IT. We execute such a systematic analysis of cloud computing and explain the technical tasks facing in this paper. In Community cloudthe “Payper use” proto typical is used. In private cloud, the computing service is disseminated for a single culture. In Hybrid cloud, the computing services is expended both the private cloud service and public cloud service. Cloud computing has three types of services. Software as a Service (SaaS), in which client ready one service and run on a single cloud, then multiple customer can access this service as per on request. Platform as a Service (PaaS), in which, it delivers the platform to generate application and keeps the application. Infrastructure as a Service (IaaS), as per period suggest to delivers the data storage, Network size, rent storage, Data centers etc. It is a.k.a. Hardware as a Service (HaaS). 2. LiteratureSurvey In cloud computing the main problem is to deliver the security of data. In Cloud computing data safety is arranged by the Authentication, Encryption & Decryption, Message authentication code, #function, and Digital signature and soon. So here we debate about some security difficulties and their answers. Use of Digital Autograph with Diffie Hellman MainConversationandAESEncryptionAlgorithmtoEnh anceData Safety in Cloud Computing[1]. Mr.PrashantRewagad and Ms.YogitaPawar [1]. Here in this paper, the assistant using three way design protection patterns. Initially Diffie-Hellman algorithm misused to generate keys for key exchange step. Then digital signature is used for confirmation, there after AES encryption algorithm is cast off to encrypt or decrypt user’s data file. Diffie- Hellman key exchange algorithm is vulnerable to main in the central round. The most thoughtful limitation is the lack of the authentication. Grouping of RSA algorithm, Arithmetical Signature and Kerberos in Cloud Safety[2]. Mehdi Hoja briand Mona Heidari[2].Now in this rag, the researcher first completes the idea of Kerberos authentication services. At the next step the Validate Server (VS) of Kerberos do confirms users and created the permitgrantingticketandsessionkeyanditdirectedtotheuse rs. The next step users send the ticket granting ticket and session key to Ticket Granting Server (TGS) for receiving the facility. Then TGS send ticket and session key for operator. In last step the operators send the request service to cloud service supplier for using the cloud service and also cloud service, deliver service to users. After doing this step user can used the cloud facility worker. But for more safety they completed RSA algorithm for encryption & decryption and then they use Digital Signature for Verification. ExecutionDigitalsignwithRSAEncryption algorithmtodeveloptheDatasecurityofcloudinCloud Computing [3]. Uma Somani, Kanika Lakhani, and Manish Mundra [3]. In this rag,, there are two creativities and B. An originality A has some data that are public data and creativity has public cloud. Now B wants some protected data from A’s cloud. So RSA algorithm and Digital signature are used for safe communication. In this way, creativity A takes data from cloud, which B needs. Now the data or document is rumpled into little line using # code function that is called Message digest. Then A encodes the message digest inside private key the outcome is in the Digital signature method. Using RSA algorithm, A will encode the digital signed signature with B’s public key and B will decode the code text to basic text with his private key and A’s public key for confirmation of signature. © 2020, IRJET | Impact Factor value: 7.34 | ISO 9001:2008 Certified Journal | Page 2251](https://image.slidesharecdn.com/irjet-v7i2472-201124103326/75/IRJET-Implementation-of-DNA-Cryptography-in-Cloud-Computing-and-using-Socket-Programming-1-2048.jpg)
![INTERNATIONAL RESEARCH JOURNAL OF ENGINEERING AND TECHNOLOGY (IRJET) E-ISSN: 2395-0056 VOLUME: 07 ISSUE: 02 | FEB 2020 WWW.IRJET.NET P-ISSN: 2395-0072 3. PROPOSEDSYSTEM Earlier piece defines the study about the cloud computing, fundamentals of cloud computing and security problems happens in cloud. Then study certain papers to crack these safety problems. Here in this paper, the Bi-serial DNA encryption algorithm is execution, that giving the two level of safety. DNA DIGITAL CODING In info science, the binary digital encoding coded by two levels 0 or 1 and a mixture of 0 and 1. But DNA digital coding can be programmed by four types of base as shown in table 1. That is (A) ADENINE and (T) THYMINE or (C) CYTOSINE and (G) GUANINE. There are possibly 4! =24 outline by encoding setup like (0123/ATGC)[4]. Table 1.DNA Digital Coding ……. Binary value DNA digital coding 00 A 01 T 10 G 11 C KEY COMBINATION Now in this exertion, we are consuming ATGCasakey. Each bit have 2 bits like A=00, T=01, G=10, and C=11 and by consuming ATGC, key mixtures is produced and give numbering individuallythatisgivenintotable.Fromthetable2,wecan produce 64 bit key standards and adding ATGC, we can produce72-bitkey(64bitsofkeymixtureand8bitsof ATGC). ATGC key is transfer to the receiver side by using Diffie Hellman key allocation algorithm. In this work, whenever the key value will be arbitrarily transformed. Table 2: Key combination A. ENCRYPTIONPROCESS Fig 1: Encryption process To know the scenario of projected work flow chart we reflect one sample. In this the sample plain text is “Hello Technocrete” and execution encryption operation Plaintext: Hello Technocrete Unicode: આશિષ ASCII: u0e0u0aau02020u0e0u0aau0b6u0e0u0aau0bfu 0e0u0a au0b7 Hexadecimal value: 5c753065305c753061615c7530323032305c753065305 c 753061615c753062365c753065305c753061615c75306 2 665c753065305c753061615c7530623 KEY COMBINATION PATTERNS VALUES AA 0101 5 AT 0011 3 AG 0001 1 AC 0010 2 TA 0110 6 TT 1111 15 TG 0111 7 TC 1001 9 GA 1010 10 GT 0100 4 GG 1000 8 GC 1100 12 CA 1110 14 CT 1011 11 CG 0000 0 CC 1101 13 © 2020, IRJET | Impact Factor value: 7.34 | ISO 9001:2008 Certified Journal | Page 2252](https://image.slidesharecdn.com/irjet-v7i2472-201124103326/75/IRJET-Implementation-of-DNA-Cryptography-in-Cloud-Computing-and-using-Socket-Programming-2-2048.jpg)
Uploaded byIRJET Journal
IRJET - Implementation of DNA Cryptography in Cloud Computing and using Socket Programming
This document discusses implementing DNA cryptography in cloud computing using socket programming. It proposes using a bi-directional DNA encryption algorithm (BDEA) that provides two layers of security. The BDEA encrypts plaintext into a DNA digital code using binary-to-DNA conversion tables, then a key combination is used to generate an amplified message. Encryption and decryption involve converting between binary, DNA digital code, and the amplified message. Snapshots demonstrate the encryption and decryption processes. Implementing BDEA in cloud computing on Amazon Web Services is discussed. The approach aims to enhance data security for non-English users compared to existing techniques.
IRJET - Implementation of DNA Cryptography in Cloud Computing and using Socket Programming
- 1. INTERNATIONAL RESEARCH JOURNALOF ENGINEERING AND TECHNOLOGY (IRJET) E-ISSN: 2395-0056 VOLUME: 07 ISSUE: 02 | FEB 2020 WWW.IRJET.NET P-ISSN: 2395-0072 IMPLEMENTATION OF DNA CRYPTOGRAPHY IN CLOUD COMPUTING AND USING SOCKET PROGRAMMING Priyanka agarwal1, sachin sharma2, Ritik sharma3 1Associate Professor, Dept. of ECE, Arya Institute of Engineering & Technology, Jaipur, Rajasthan, India 2,3Student, Dept. of ECE, Arya Institute of Engineering & Technology, Jaipur, Rajasthan, India -----------------------------------------------------------------------***--------------------------------------------------------------------- Abstract- In the field of distributed computing Cloud computing is the latest technology which provides various online and on-demand services for data storage & network services and etc. lots of organizations are excited to use cloud services cause of data security problems as the data lives on the cloud services provider’s servers. The BDEA (Bi-directional DNA Encryption Algorithm) is one of data security techniques. However, the presenting techniques eye on only for ASCII character set, ignoring the non- English user of the cloud computing Keywords-Cloud computing, Data security issues, Bi- DirectionalDNAEncryptionAlgorithm,DNAdigitalcode, SocketProgramming.) 1. INTRODUCTION Cloud computing has newly reached status and developed into a chief trend in IT. We execute such a systematic analysis of cloud computing and explain the technical tasks facing in this paper. In Community cloudthe “Payper use” proto typical is used. In private cloud, the computing service is disseminated for a single culture. In Hybrid cloud, the computing services is expended both the private cloud service and public cloud service. Cloud computing has three types of services. Software as a Service (SaaS), in which client ready one service and run on a single cloud, then multiple customer can access this service as per on request. Platform as a Service (PaaS), in which, it delivers the platform to generate application and keeps the application. Infrastructure as a Service (IaaS), as per period suggest to delivers the data storage, Network size, rent storage, Data centers etc. It is a.k.a. Hardware as a Service (HaaS). 2. LiteratureSurvey In cloud computing the main problem is to deliver the security of data. In Cloud computing data safety is arranged by the Authentication, Encryption & Decryption, Message authentication code, #function, and Digital signature and soon. So here we debate about some security difficulties and their answers. Use of Digital Autograph with Diffie Hellman MainConversationandAESEncryptionAlgorithmtoEnh anceData Safety in Cloud Computing[1]. Mr.PrashantRewagad and Ms.YogitaPawar [1]. Here in this paper, the assistant using three way design protection patterns. Initially Diffie-Hellman algorithm misused to generate keys for key exchange step. Then digital signature is used for confirmation, there after AES encryption algorithm is cast off to encrypt or decrypt user’s data file. Diffie- Hellman key exchange algorithm is vulnerable to main in the central round. The most thoughtful limitation is the lack of the authentication. Grouping of RSA algorithm, Arithmetical Signature and Kerberos in Cloud Safety[2]. Mehdi Hoja briand Mona Heidari[2].Now in this rag, the researcher first completes the idea of Kerberos authentication services. At the next step the Validate Server (VS) of Kerberos do confirms users and created the permitgrantingticketandsessionkeyanditdirectedtotheuse rs. The next step users send the ticket granting ticket and session key to Ticket Granting Server (TGS) for receiving the facility. Then TGS send ticket and session key for operator. In last step the operators send the request service to cloud service supplier for using the cloud service and also cloud service, deliver service to users. After doing this step user can used the cloud facility worker. But for more safety they completed RSA algorithm for encryption & decryption and then they use Digital Signature for Verification. ExecutionDigitalsignwithRSAEncryption algorithmtodeveloptheDatasecurityofcloudinCloud Computing [3]. Uma Somani, Kanika Lakhani, and Manish Mundra [3]. In this rag,, there are two creativities and B. An originality A has some data that are public data and creativity has public cloud. Now B wants some protected data from A’s cloud. So RSA algorithm and Digital signature are used for safe communication. In this way, creativity A takes data from cloud, which B needs. Now the data or document is rumpled into little line using # code function that is called Message digest. Then A encodes the message digest inside private key the outcome is in the Digital signature method. Using RSA algorithm, A will encode the digital signed signature with B’s public key and B will decode the code text to basic text with his private key and A’s public key for confirmation of signature. © 2020, IRJET | Impact Factor value: 7.34 | ISO 9001:2008 Certified Journal | Page 2251
- 2. INTERNATIONAL RESEARCH JOURNALOF ENGINEERING AND TECHNOLOGY (IRJET) E-ISSN: 2395-0056 VOLUME: 07 ISSUE: 02 | FEB 2020 WWW.IRJET.NET P-ISSN: 2395-0072 3. PROPOSEDSYSTEM Earlier piece defines the study about the cloud computing, fundamentals of cloud computing and security problems happens in cloud. Then study certain papers to crack these safety problems. Here in this paper, the Bi-serial DNA encryption algorithm is execution, that giving the two level of safety. DNA DIGITAL CODING In info science, the binary digital encoding coded by two levels 0 or 1 and a mixture of 0 and 1. But DNA digital coding can be programmed by four types of base as shown in table 1. That is (A) ADENINE and (T) THYMINE or (C) CYTOSINE and (G) GUANINE. There are possibly 4! =24 outline by encoding setup like (0123/ATGC)[4]. Table 1.DNA Digital Coding ……. Binary value DNA digital coding 00 A 01 T 10 G 11 C KEY COMBINATION Now in this exertion, we are consuming ATGCasakey. Each bit have 2 bits like A=00, T=01, G=10, and C=11 and by consuming ATGC, key mixtures is produced and give numbering individuallythatisgivenintotable.Fromthetable2,wecan produce 64 bit key standards and adding ATGC, we can produce72-bitkey(64bitsofkeymixtureand8bitsof ATGC). ATGC key is transfer to the receiver side by using Diffie Hellman key allocation algorithm. In this work, whenever the key value will be arbitrarily transformed. Table 2: Key combination A. ENCRYPTIONPROCESS Fig 1: Encryption process To know the scenario of projected work flow chart we reflect one sample. In this the sample plain text is “Hello Technocrete” and execution encryption operation Plaintext: Hello Technocrete Unicode: આશિષ ASCII: u0e0u0aau02020u0e0u0aau0b6u0e0u0aau0bfu 0e0u0a au0b7 Hexadecimal value: 5c753065305c753061615c7530323032305c753065305 c 753061615c753062365c753065305c753061615c75306 2 665c753065305c753061615c7530623 KEY COMBINATION PATTERNS VALUES AA 0101 5 AT 0011 3 AG 0001 1 AC 0010 2 TA 0110 6 TT 1111 15 TG 0111 7 TC 1001 9 GA 1010 10 GT 0100 4 GG 1000 8 GC 1100 12 CA 1110 14 CT 1011 11 CG 0000 0 CC 1101 13 © 2020, IRJET | Impact Factor value: 7.34 | ISO 9001:2008 Certified Journal | Page 2252
- 3. INTERNATIONAL RESEARCH JOURNALOF ENGINEERING AND TECHNOLOGY (IRJET) E-ISSN: 2395-0056 VOLUME: 07 ISSUE: 02 | FEB 2020 WWW.IRJET.NET P-ISSN: 2395-0072 Binary value: 01011100011101010011000001100101001100000101110 00111010100110000011000010110000101011100011101 01001100000011001000110000001100100011000001011 10001110101001100000110010100110000010111000111 01010011000001100001011000010101110001110101001 10000011000100011011001011100011101010011000001 10010100110000010111000111010100110000011000010 11000010101110001110101001100000110001001100110 01011100011101010011000001100101001100000101110 00111010100110000011000010110000101011100011101 01001100000110001000110111 DNA Digital coding: From Table 1 we can write TTCATCTTACAATGTTACAATTCATCTTACAATGATTGAT TTCATCTTACAAACAGACAAACAGACAATTCATCTTACAATG TTACAATTCATCTTACAATGATTGATTTCATCTTACAATGAG ACTGTTCATCTTACAATGTTACAATTCATCTTACAATGAT TGATTTCATCTTACAATGAGTGTGTTCATCTTACAATGTT ACAATTCATCTTACAATGATTGATTTCATCTTACAATGAG ACTC Now from table 2, the amplified message is generated, Amplified Message 11111110100111110010010101111111001001011111111 01001111100100101011100110111001111111010011111 00100101001100010010010100100001001001011111111 10100111110010010101111111001001011111111010011 11100100101011100110111001111111110100111110010 01010111000100100111111111101001111100100101011 11111001001011111110100111110010010101110011011 10011111111010011111001001010111000101110111111 11110100111110010010101111111001001011111111010 01111100100101011100110111001111111110100111110 0100101011100010010100 B. DECRYPTIONPROCESS Now at receiver side, the receiver receives the amplified message and ATGC key for decryption. Fig: 2: Decryption process Amplified Message 11111110100111110010010101111111001001011111 11101001111100100101011100110111001111111101 00111110010010100110001001001010010000100100 10111111111010011111001001010111111100100101 11111110100111110010010101110011011100111111 11101001111100100100111000100100111111111101 00111110010010101111111001001011111111010011 11100100101111001101110011111111101001111100 10010101110001011101111111111010011111001001 01011111110010010111111110100111110010010101 10011011100111111111010011111001001010111000 100101001 © 2020, IRJET | Impact Factor value: 7.34 | ISO 9001:2008 Certified Journal | Page 2253
- 4. INTERNATIONAL RESEARCH JOURNALOF ENGINEERING AND TECHNOLOGY (IRJET) E-ISSN: 2395-0056 VOLUME: 07 ISSUE: 02 | FEB 2020 WWW.IRJET.NET P-ISSN: 2395-0072 Now using ATGC key and key combination, retrieve original DNA Digital code. TTCATCTTACAATGTTACAATTCATCTTACAATGATTGATT TCATCTTACAAACAGACAAACAGACAATTCATCTTACAATG TTACAATTCATCTTACAATGATTGATTTCATCACAATGAGAC TGTTCATCTTACAATGTTACAATTCATCTTACAATGATTGAT TTCATCTTACAATGAGTGTGTTCATCTTACAATGTTACAATTC ATCTTACAATGATTGATTTCATCTTACAATGAGACTC From the table of DNA digital coding we can generate.01011100011101010011000001100101001100 0001011000111010100110000011000010110000101011 1000111010100110000001100100011000000110010001 1000001011100011101010011000001100101001100000 1011100011101010011000001100001011000010101110 0011101010011000001100010001101100101110001110 1010011000001100101001100000101110001110101001 1000001100001011000010101110001110101001100000 1100010011001100101110001110101001100000110010 100110000010 11100011101010011000001100001011000010101110001 110101001100000110001000110111 Hexadecimal value: 5c753065305c753061615c7530323032305c753065305c75 3061615c753062365c753065305c753061615c753062665c 753065305c753061615c75306237 ASCII: u0e0u0aau02020u0e0u0aau0b6u0e0u0aau0bfu 0e0u0a au0b7 Unicode: આશિષ Plaintext: Hello Technocrat 4.SNAPS OF PROPOSED WORK(ENCRYPTION) Fig. 3: Encryption operation Fig.4: Encryption flow 5. SNAPS OF PROPOSED WORK(DECRYPTION) Fig.5: Decryption Process Fig.6: Decryption flow © 2020, IRJET | Impact Factor value: 7.34 | ISO 9001:2008 Certified Journal | Page 2254
- 5. INTERNATIONAL RESEARCH JOURNALOF ENGINEERING AND TECHNOLOGY (IRJET) E-ISSN: 2395-0056 VOLUME: 07 ISSUE: 02 | FEB 2020 WWW.IRJET.NET P-ISSN: 2395-0072 WORKING ON AMAZON WEB SERVICE Fig.8: Encryption inAWS Fig.9: Decryption in AWS 6. CONCLUSION Data safety is the important task for cloud usability. Various algorithms like RSA, Diffie-Hellman, DNA encoding etc. are obtainable to deliver data security for the data kept on cloud. Digital signatures, Extensible Verification Procedures are used for verifications. Using BDEA algorithm, we achieve 2-layer safety for ASCII character sets. The future system focuses on spreading the BDEA process to be used with Unicode personality set. This can help reach to the wider public of the cloud operators. The upcoming work will focus on the likely attacks and cryptanalysis of the cipher text and amount its asset. REFERENCES 1. Prashant Rewagad, YogitaPawar, “Use of Digital Sign with Diffie-Hellman Key Exchange and AESEncryptionAlgorithmtoEnhanceDataSeftyinC loudComputing”2013global session on Communication System and Network Technologies (IEEE ComputerSociety). 2. Uma Somani, Kanika Lakhani, Manisha Mundra, ”Implementing Digital Signature with RSA Encryption Algorithm to Enhance the Data Security of Cloud in Cloud Computing”-2010 IEEE 1st International Conference on Parallel, Distributed and Grid Computing (PDGC-2010). 3. Mehdi Hojabri& Mona Heidari “Merger of RSA algorithm, Digital Sign and KERBEROS in Cloud Computing” Global Session on Software Skill and Computer Engineering (STACE-2012). 4. Ashish Prajapati, Amit Rathod “Enhancing security in cloud computing using Bi-Directional DNA Encryption Algorithm”, International Conference on Intelligent Computing, Communication & Devices.(ICCD- 2014),Springer. © 2020, IRJET | Impact Factor value: 7.34 | ISO 9001:2008 Certified Journal | Page 2255